First Molecular Identification of Sunfish in North Bali Water

Journal of Advances in Tropical Biodiversity and Environmental Sciences 3(1): 12-16, February 2019     (p-ISSN: 2549-6980)

DOI: 10.24843/atbes.v03.i01p04 Available online at: https://ojs.unud.ac.id/index.php/ATBES/article/view/49700

12

First Molecular Identification of Sunfish in North

Bali Water

I Made Oka Riawan^1*, Gede Iwan Setiabudi¹, Made Merdana², I Putu Mangku Mariasa³, Kadek Teguh Wirasastra⁴

The Faculty of Mathematic and Natural Science, Ganesha Education University¹ Faculty of Veterinary Medicine, Udayana University²

True Scuba Dive Center³

NMS Bali⁴

Singaraja, Bali

• ^*Corresponding author: okasmansa@gmail.com

Abstract Stranded Sunfish was found in North Bali, and we collected some part that was used for molecular identification. Samples were amplified at the d-loop locus (control region) using the PCR (Polymerase Chain Reaction) method. Primers used in PCR were H16498 as primary front (forward) and L15812 as reverse primer. Similarity value of 95% after alignment with Mola ramsayi (accession number accession AY940824) on GenBank wa obtained, with the gaps of the nucleotide was 1%. The stranded sunfish identified using partial sequence mtDNA was the same species as the species Mola ramsayi.

Keywords: stranded fish, Mola ramsayi, partial sequence.

• I.    INTRODUCTION

Molidae is the family with large number of species, primarily pelagic members of the Tetraodontiformes. Commonly known as ocean sunfish, and have a distinctive laterally compressed shape and “chopped off” appearance [1-3]. The median fins is primarily for swimming, they lack of ribs, caudal bones, pelvic fins, spines and have fewer vertebrae than any other fish [4]. Unlike most fish, sunfish has two distinct larva phases. A typical Tetraodon-like larval and another highly transformative stage resulting in the complete absorption of the tail [1].

Members of Molidae distributed in both temperate and tropical waters. These coasltal regions include the Central and Southern of California , Malaga of Spain, Cape Town of South Africa, Kamogawa of Japan, Hua Lien of Taiwan’s, Camogli of Italy and Galapagos Islands of Ecuador’s. In Indonesia, sunfish are found in southern coastal region of Bali, particularly in the area of Lembongan and Penida Islands, which those islands are belong to Bali region [5]. It has never been recorded to occur in Northern coastal region of Bali.. The species of sunfish found in coastal regions of Lembongan and Penida is Mola ramsayi, with density of 1 individual per 6.8 km [6]. In 2017 a sunfish was found stranded in the North Bali. Rescue process have been tried out repeatedly, but the fish was

suffered and unbalance when swimming and were finally declared died on location. The fish was brought to the Biology Laboratory of Ganesha Education University for identification. The present study aimed to identify the species using molecular identification.

• II.    RESEARCH METHOD

Sample Collection and preparation

The samples were obtained from stranded fish found in northern coastal of Bali, Singaraja. Sample were transported to the laboratory and the morphometrics such as the weight and length were measured. Some muscle tissues were collected for molecular identification.

Extraction method

DNA extraction of samples was carried out using the 10% chelex method [7]. Sample of muscle tissue was cut with the size of ±2mm, immersed in 10% chelek solution, vented for 20 seconds and centrifuged for 20 seconds. The sample was then heated on a heatblock at 95°C for 45 minutes, mixed in a vortex and centrifuged for another 20 seconds.

Polymerase chain reaction

Samples were amplified at the d-loop locus (control region) using the PCR (Polymerase Chain Reaction)

DOI: 10.24843/atbes.v03.i01p04

method. Primers used in PCR are H16498 (5'-CCTGAAGTAAGAACCAGATG-3') as primary front and L15812 (5'-CCTCCCTAAGACTCAAGGAAG-3') as reverse primer [8]. The following is the mixture of reagents used in the PCR process for each sample. Master Mix: ddH2O: 10 ul, Primary 1: 1.25 ul, Primary 2: 1.25 ul, Bioline Ready Mix: 12.5 ul, Extraction template/DNA product: 1 ul.

All reagents are inserted and mixed into the PCR tube and run on a thermalcycler machine with the following temperature optimization. Pre-denaturation: 94^oC 15 seconds, next denaturation 94^oC 30 seconds, annealing 50^oC 30 seconds, extension: 72^oC 45 seconds, and continued to post-extension 72^oC 5 minutes. The PCR process was carried out as many as 38 cycles.

Electrophoresis

One percent agarose gel was used for the electrophosesis. This gel is made from a mixture of 80 ml SB buffer (sodium & boric acid) and 0.8 mg agarose. Both ingredients are mixed in a glass beaker or erlenmeyer flask and heated until completely dissolved. Next, the liquid is poured into the mold, then cooled for ±45 minutes until the gel thickens. Samples were prepared by mixing 1µl loading dye in 3 µl

Available online at: https://ojs.unud.ac.id/index.php/ATBES/article/view/49700

13 PCR product. Mixed samples were inserted in to the gel well. Lader marker was inserted on one end of the gel.

Sequencing

The amplified PCR product was sent for sequensing to the UC Berkeley sequencing facility following the method ofSanger. The sequences of DNA was analyzed in MEGA 6 and BLAST by comparing with Gene Bank to identify the fish species.

• III.    RESULT AND DISCUSSION

The total lengths of the partial loop mitochondrial amplification was 419 bp. The alignment of the mitochondrial DNA to the Bass et al. (2005) with the accession of AY940824found 95% similarity with 1% nucleotide gaps (Table 1). Therefore, it was believe that using partial sequence mtDNA, the stranded sunfish found in Singaraja coastal region was similar to that of Mola ramsayi identified by Bass et al (2005) [3].

Mitochondrial DNA alignment in this study found that molecular characteristics of the stranded sunfish was very identical to the molecular data of the reference species from GenBank, that was Mola ramsayi. However, 5% differences

TABLE I

BLAST RESULT STRANDED OCEAN SUNFISH (Mola ramsayi) WITH Mola ramsayi ACCESSION NUMBER AY940824 (Bass et al., 2005)

Score	Expect	Identities	Gaps	Strand
540 bits (292)	3e-158	329/346 (95%)	5/346 (1%)	Plus/Plus

Query Sbjct	51 1	ATGGTGGGtatatacatatatgtattatcaccatatatatatatataCCATTAATCAATA |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ATGGTGGGTATATACATATATGTATTATCACCATATATATATATGTACCATTAATCAATA	110 60
Query	111	ATATCTTGCGAGCAATAAATTATATATGGGATAAAATGATCCAGAACATTGCAAGAAAAC |||||||||||||||||||||||||||| |||||||||||||||||||  |||||||||	170
Sbjct	61	TTATCTTGCGAGCAATAAATTATATATGGAATAAAATGATCCAGAACATCACAAGAAAAC	120
Query	171	ACGAAATCTGAATGTATAAAAGACATAACACTAGAC-AGGGCATCCTGACTAAAAAGTTA | ||||| ||||||||||||||||||||||||| || ||| ||||||||||||||| |||	229
Sbjct	121	ATGAAATTTGAATGTATAAAAGACATAACACTA-ACTAGGACATCCTGACTAAAAAATTA	179
Query	230	AGCCCTAACACTTCAAATAATTTAAACAGATATACTTTGACTCAACATTCCTTCAAGGCA ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||	289
Sbjct	180	AGCCCTAACACTTCAAATAATTTAAACAGATATACTTTGACTCAACATTCCTTCAAGACA	239
Query	290	AATGCTTAATGTAGTAAGAACCGACCATCAGTTGATTTCTTAATGCATACTCTTATTGAT ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||	349
Sbjct	240	AATACTTAATGTAGTAAGAACCGACCATCAGTTGATTTCTTAATGCATACTCTTATTGAT	299
Query	350	GGTGAGGGACAATTATTCGTG--GGGGTCACACTTAGTGAATTATT 393 |||||||||||||||| ||||   ||||||||| |||||||||||||
Sbjct	300	GGTGAGGGACAATTAT-CGTGGTGGGGTCACATTTAGTGAATTATT 344

was still recorded of all sequence analyzed. This is probably due to the difference of the amplification primer used, namely H16498 (5'-CCTGAAGTAAGAACCAGATG-3 ') as primary front (forward) and L15812 (5'-

CCTCCCTAAGACTCAAGGAAG-3') as reverse primer [8]. Whereas the reference sequence uses primers A (5'-TTCCACCTCTAACTCCCAAAGCTAG-3'), E (5'-CCTGAAGTAGGAACCAGATG-3') and M (5'-

DOI: 10.24843/atbes.v03.i01p04 Available online at: https://ojs.unud.ac.id/index.php/ATBES/article/view/49700

TATGCTTTAGTTAAGGCTACG-3') [3][9]. The primary difference allows the sequence variation amplified by the same in the same control loop region. To support the results of this alignment, morphology was also identified. The morphological characters refer to Fraser-Brunner [1].

Mola ramsayi and M. mola almost similar morphological character, described by Fraser-Brunner [1]. They share several unique anatomical features, of which the most striking is the lack of almost all osteological elements of the caudal fin structures, which are replaced by a pseudocaudal fin [4][10]. M. mola have rougher skin and reduced band of denticles running between their dorsal and anal fins along the pseudotail known as a clavus. In M. ramsayi, the clavus region is supported by 14-24 fin rays and 12 ossicle [5][11]. This character is in accordance with stranded sunfish in this study, after surgery to ensure ray structure found 16 fin rays in clavus and ends at the ossicle at the end of clavus. Whereas when on M. mola the clavus has 12 fin rays, eight

14 of which bear ossicles [12]. Beside that, M. ramsayi does not have the smooth band at the base of the clavus [13-14], it similar to the specimen in this research. The stranded ocean sunfish were we found in this research has 173cm total length, and 130 cm width (Table 2).

The phylogenetic tree (Figure 1) shown the relationship between species of Mola mola and Mola ramseyi, presented in three branches. The evolutionary history was inferred using the UPGMA method [15].

TABLE II

MORPHOMETRIC OF STRANDED OCEAN SUNFISH IN PRESENT

STUDY (Mola ramsayi)
Body Length (cm)		Fins Length (cm)
Total length	173	Length of ventral fin	78
body width	130	Width of ventral fin	30
Length of clavus	36	Length of dorsal fin	83
Width of clavus	82	Width dorsal fin	31

Mola ramsayi (present study)

Mola ramsayi (accession AY940824)

Mola mola (accession AY940817)

-I---------------------------------------------------1--------------------------------------------------1--------------------------------------------------1---------------------------------------------------1--------------------------------------------------1

0.10                 0.08                 0.06                0.04                 0.02                 0.02

Fig. 1. Relationships of Mola ramsayi from present study and Mola from previous study by Bass et al., (2005)

The optimal tree with the sum of branch length= 0.23223534 was presented. The same lengh of tree units was used for the evolutionary distances. The evolutionary distances were calculted employing the Maximum Composite Likelihood method [16] and were in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated. There were a total of 339 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 [17]. It was found that the specific cluster of Mola ramsayi species has different molecular character to the Mola mola.

The morphological similarity between the specimens M. ramsayi (present study), and M. ramsayi were presented in Table 3. Both have similar morphological characters, those were by the present of smooth band, number of clavus fin rays, the ratios of ossicle size versus space between ossicle. [12]. The morphological characters of Mola seem to be well consistent with the key character of Mola ramsayi proposed

by Fraser-Brunner [1], accept for the presence or absence of the smooth band. It may caused by age of the specimens, but further study is necessary [13][18].

In comparison Mola mola, the only other ocean sunfish species, they show similar dive behavior. Mola mola has been recorded in temperatures as low as 1.8^o C off Japan [6][18] and high as 30⁰C off the southeast coast of the US and Bahamas [19-20]. The stranded M. ramsayi found in this study may have originated from the population of M. ramsayi in Lembongan Bali, the closest habitat of M. ramsayi found around Bali island. Research that has been carried out, M. ramsayi has random migration pattern They spent around 89 days for travelling in the distance of 747 km. Migration of ocean sunfish was also found depended on abundance of prey, temperature and other factors [19][2122]. Further study is still required to investigated the cause of the stranded M. Ramsayi. Water pollution or other factor may contribute to this accorence.

DOI: 10.24843/atbes.v03.i01p04 Available online at: https://ojs.unud.ac.id/index.php/ATBES/article/view/49700

15

TABLE III

COMPARISON OF MORPHOLOGICAL CHARACTERS OF MOLA IN PRESENT STUDY SPECIMEN WITH OTHERS MOLA SPECIMEN

FROM PREVIOUS STUDIES

Species specimen	Present study M. ramsayi	Sawai et al., 2017a		Jawad, 2012 M. ramsayi	Jawad et al., 2013 M. mola
		M. ramsayi	M. mola
Total length (cm)	173.0	91.6	91.6	135.0	135.0
Ossicles	12	12-13	11-13	12	8
Clavus fin rays	14	19	No data	16	12
Smooth band	Present	Present	Present	absent	Present
Ossicle size (OS) versus width of spaces between ossicles (SS)	OS>SS	OS>SS	OS>SS	OS>SS	OS<SS
Head bump	Absent	Absent	Absent	No data	No data
Shape of clavus	Round	Round	Round	No data	No data

• IV.    CONCLUSION

The sunfih which stranded on Singaraja coast was identified as Mola ramsayi which has been proven by 95% similarity from molecular identification of d-loop control region, partial sequence of mtDNA and morphological characters that correspond to the key characters of M. ramsayi.

ACKNOWLEDGMENT

This work was supported by NMS Bali for collecting tissue sample and preserving the sunfish. Bionesia Foundation who help to get partial sequence, and the Ministry of Marine Affairs and Fisheries who support this project.

REFERENCES

[1]Fraser-Brunner, A. 1951. The ocean sunfishes (family Molidae). Bulletin of the British Museum (Natural History), Zoology. 1: 87– 121.

[2]Smith, M.M, P.C. Heemstra. 1986. Smith’s Sea Fishes, 6th edn. Springer, Berlin Heidelberg, New York.

[3]Bass, A.L, H. Dewar, T. Thys, J.T. Streelman, S. A. Kar 2005. Evolutionary divergence among lineages of the ocean sunfish family, Molidae (Tetraodontiformes). Marine Biology, 148(2): 405-414.

[4]Tyler, J.C. 1970. The progressive reduction in number of elements supporting the caudal fin of fishes of the order Plectognathi. Proc Acad Nat Sci Phila. 122. 1-85.

[5]Thys, T., M.J. Whitney, A. Hearn, K.C. Weng, C. Peñaherrera, L. Jawad, J. Alfaro-Shigueto, J.C. Mangel, A.K. Stephen. 2013. First record of the southern ocean sunfish, Mola ramsayi, in the Galapagos Marine Reserve. Marine Biodiversity Records. 6:1-4.

[6]Thys, T., J.P. Ryan, K.C. Weng,, M. Erdmann, J. Tresnati. 2016. Tracking a marine ecotourism star: movements of the short ocean sunfish Mola ramsayi in Nusa Penida, Bali, Indonesia. Journal of Marine Biology, (2016): 6 pages.

• [7]    Walsh, P., D.A. Metzger, R. Higuchi. 1991. Chelex-100 as a medium for simple extraction of DNA for PCR based typing from forensic material. Biotechniques, 10: 506-513.

• [8]    Rosel, P.E., A.E. Dizon, J.E. Heyning. 1994. Genetic analysis of sympatric morphotypes of common dolphins (genus Delphinus). Marine Biology, 119(2): 159-167.

• [9]    Lee, WJ., J. Conroy, W.H. Howell, T.D. Kocher. 1995. Structure and evolution of teleost mitochondrial control regions. J Mol Evol. 41:54-66.

• [10]    Sawai, E., Y. Yamanoue, L.A. Jawad, J. Al-Mamry, Y. Sakai. 2017a. Molecular and Morphological Identification of Mola Sunfish Specimens (Actinopterygii: Tetraodontiformes: Molidae) from the Indian Ocean. Species Diversity. 22:99-104.

• [11]    Sawai, E., Y. Yamanoue, M. Nyegaard, Y. Sakai. 2017b. Redescription of the bump-head sunfish Mola alexandrine (Ranzani 1839), senior synonym of Mola ramsayi (Giglioli 1883), with designation of a neotype for Mola mola (Linnaeus 1758) (Tetraodontiformes: Molidae). Ichthyological Research, 65: 142160.

• [12]    Jawad, L., J. Al-Mamry, L. Al-Kharusi. 2012. Fist record of Mola ramsayi from the Sea of Oman, Sultanate of Oman. Marine Bidodiversity Record, 5: e63.

• [13]    Jawad, L. 2013. First documented record of the ocean sunfish, Mola ramsayi (Linnaeus) from the Sea of Oman, Sultanate of Oman (Teleostai: Molidae). Stuttgarter Beitrage zur Naturkunde, A (6): 287-290.

• [14]    Yoshita, Y., Y. Yamanoue, K. Sagara, M. Nishibori, H. Kuniyoshi, T. Umino, Y. Sakai, H. Hashimoto, K. Gushima. 2009. Phylogenetic relationship of two Mola sunfishes (Tetraodontiformes: Molidae) occurring around the coast of Japan, with notes on their geographical distribution and morphological characteristics. Ichthyological Research, 56: 232-244.

• [15]    Sneath, P.H.A., R.R. Sokal. 1973. Numerical Taxonomy. Freeman, San Francisco.

• [16]    Tamura, K., MM. Nei, S. Kumar. 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences (USA). 101: 11030-11035.

• [17]    Tamura K., G. Stecher, D Peterson, A. Filipski, S. Kumar. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution. 30: 2725-2729.

• [18]    Dewar, H., T. Thys, S.L. Teo. 2010. Satellite tracking the world’s largest jelly predator, the ocean sunfish, Mola mola, in the Western Pasific. Journal of Experimental Marine Biology and Ecology, 393(1-2): 32-42.

• [19]    Potter, I.F., W.H. Howell. 2011. Vertical movements and behavior of the ocean sunfish, Mola mola in the Northwest Atlantic. Marine Biology. 158(3):531-540.

• [20]    Houghton, J.D.R., T.K. Doyle, J. Davenport, G.C. Hays. 2006. The ocean sunfish Mola mola: insights into distribution, abundance and behavior in the Irish and Celtic Seas. J. Mar. Biol. 86(5): 1237-1243.

• [21]    Thys, T.M., J.P. Ryan, H. Dewar, C.R. Perle, K. Lyons, J. O’Sullivan, C. Farwell, M.J. Howard, K.C. Weng, B.E. Lavaniegos, G.G. Castro, L.E.M Bojorquez, E.L. Hazen, S.J. Bograd. 2015. Ecology of the Ocean Sunfish, Mola mola, in the southern California

DOI: 10.24843/atbes.v03.i01p04 Available online at: https://ojs.unud.ac.id/index.php/ATBES/article/view/49700

16

Current System. Journal of Experimental Marine Biology and

Ecology. 471:64-76.

• [22]    Santini, F., J.C. Tyler. 2003. A phylogeny of the families of fossil and extant teraodontiform fishes (Acanthomorpha, Tetraodontiformes), Upper Cretaceus to Recent. Zoological Journal of the Linnean Society. 139:565-617.